Hacker Newsnew | past | comments | ask | show | jobs | submit | poyu's commentslogin

> opportunity to take the bulk components off boards, test and sort them, and sell them in bulk.

I think this is already happening in China for certain components.


I think it's the PDF files that were attached to the emails, since they're base64 encoded.


    but I would never want to have to interact with
That is its job security ;)


  Location: Los Angeles, CA
  Remote: Yes
  Willing to relocate: No
  Technologies: Node.js, Express, jQuery, PostgreSQL, NGINX/HAProxy, Docker/containers, Linux
  Résumé/CV: resume.poyu.xyz
  Email: hn@poyu.xyz
10+ years experience building web apps and services, computer is my hobby. Currently an engineering manager that still codes and work with PMs. My current job consists of talking with PMs, sorting out initial requirements and leading the team through thorough feature refinement process, also discussing with operations team to lay out plans for new features.

Looking for a change since my current company got acquired, and I've been in this role for quite a while now. Hoping to work on something meaningful, to myself or the community.


I interpreted "inactive" as the link that the shortener is linking to is not responding.


No. Inactive means that the short URL hasn't been accessed in a while.


But that doesn’t make any sense. A link might be printed in a book. Nobody accessed it, yet they might at some point. Such a service is quite good for printing in books, instead of QR-codes.


It makes sense in a technical capacity, not in an epistemic one. I never claimed it is the right thing to do.


Made it sound like it's a computer, is it Turing complete?


It's fundamentally different than a computer and arguably more complete.

The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem


This is crazier: https://www.sciencealert.com/are-we-all-quantum-computers-wi...

About CRISP, it's like the ultimate Perl+Regex for the body.


sounds more like sed


Perl and awk can do everything sed(1) does, but it an easier way.


I know


"Bumps around until it hits" sounds like a set of magnets arranged to only mate up in a specific direction. Except we have four nucleotides rather than only two magnetic poles.


If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete.

Hilarity subsequently ensues.


Cells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...)

Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.

Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.


As I get older, I'd be happy with some minor incremental progress on addressing myopia and hyperopia.


Wouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.


Made me think of

    It was only in college, when I read Douglas Hofstadter’s Gödel, Escher, Bach, that I came to understand cells as recursively self-modifying programs. The language alone was evocative. It suggested that the embryo—DNA making RNA, RNA making protein, protein regulating the transcription of DNA into RNA—was like a small Lisp program, with macros begetting macros begetting macros, the source code containing within it all of the instructions required for life on Earth. Could anything more interesting be imagined?

    Someone should have said this to me:

    > Imagine a flashy spaceship lands in your backyard. The door opens and you are invited to investigate everything to see what you can learn. The technology is clearly millions of years beyond what we can make.
    >
    > This is biology.
   
    –Bert Hubert, “Our Amazing Immune System”
from https://jsomers.net/i-should-have-loved-biology/


>> Imagine a flashy spaceship

I misread this as "fleshy" for a moment, and the quote almost works better that way.


Me too. It did. Huh.


This system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size).

True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.


Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.


I think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...


Sounds kind of like the infinite tape machine....


About 6 billion letters in human DNA.


Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.


TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare

(core war, anybody?)


I don't know if it still is, but, for a while, Perl was actually fairly popular in bioinformatics: https://bioperl.org/


So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.


I thought that just means they're buying him out?


> I forget the name of the app that would install custom themes/docks

Shapeshifter! Those were the days...


This exactly scenario is why our company is so afraid to put AI into production without the results being completely clear that it could be wrong. But if there’s even a chance that it could be wrong, why are we offering it to the user? How much due diligence does the user need to do? Does the benefits outweigh the cons?


The AI should be required to cite the source. But that wont work for LLM though as they are just random words put together in a way that is statistically probable.


In this case the problem is caused by citing sources - Google finds a list of links using their existing search tech and then produces a response using RAG based on the search results.

That’s where the problem is - it’s originally citing a Reddit post where someone recommends it as a joke, then Business Insider through citogenisis from the original story.

Pure LLMs (no RAG) don’t make this mistake - Claude will tell you it’s a bad idea and will taste bad.


I have asked chatgpt for sources, and it gave me links which actually worked.


In the past it was called sloppiness, today less and less people seem to care.


> But if there’s even a chance that it could be wrong, why are we offering it to the user?

Corporations push code written by fresh junior devs into production every day, breaking stuff that could cost them tens of thousands. Do they care? On paper, very much so, in practice, they dgaf.


That sounds more like Alibaba, where it operates like a B2B type transaction. In my experience, just talk to them, sure it might take more time but you can usually get a good price if you’re buying higher quantities.


Guidelines | FAQ | Lists | API | Security | Legal | Apply to YC | Contact

Search: